Skip to main content

Table 1 Primer pairs used to amplify the seven overlapping fragments of HVS-I with molecular details

From: Pet fur or fake fur? A forensic approach

Amplicon size (bp) Primer name Primer range Primer sequence 5′-3′ Sequence information range (bp) Reference
170 L15422 H15555 15404-15422 15555-15574 CTCTTGCTCCACCATCAGC TTATATGCATGGGGCAAACC 133 [124]
219 L15511 H15692 15490-15511 15692-15709 ACTGTGCTATGTCAGTATCTCC TTGATGGTTTCTCGAGGC 181 [124]
246 L15574 H15780 15555-15574 15780-15801 GGTTTGCCCCATGCATATAA AAGTAAGAACCAGATGCCAGGT 206 [126]
148 L15764 H15873 15744-15764 15873-15892 CCCATACTAACGTGGGGGTTA TGTGTGATCATGGGCTGATT 109 [126]
129 L15857 H15945 15836-15857 15945-15965 ATTCTCGCAAATGGGACATC GCGGTCGTAGGTGAGTGATAG 88 [126]
137 L15892 H15991 15873-15892 15991-16010 AATCAGCCCATGATCACACA GGCATATTCCCTGAGAGCAG 99 [126]
154 L15982 H16097 15963-15982 16097-16117 CGCAACGGCACTAACTCTAA TGTCCTGAAACCATTGACTGA 115 [126]
\