Skip to main content

Table 1 SNaPshot primers designed for WSMV

From: Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

Namea Length (nt) Sequence (5′-3′)b TM Strandc Final Conc. (μM)
30 C 30 GACTGGCGTGTTCTCCCTCACATCATCTGC 65.1 F 0.1
35 C 35 GACTGACTGACAACTGAACAACTCAACACCTGGAT 63.5 R 0.2
40 C 40 GACTGACTGACTGACTGGCATATCTGTTGTCGATAAGTTC 63.5 F 0.1
45 C 45 GACTGACTGACTGACTGACTGTAGTTTCTACTGTGCTCACGCAAG 66.5 F 0.2
50 C 50 GACTGACTGACTGACTGACTGACTTTCGCAGCTTTGTACATCGGTTCAAT 67.6 F 0.4
55 C 55 GACTGACTGACTGACTGACTGACTGACTGATCTCTGGGCACGTTGTGTTGATTAT 72.05 F 0.4
60 C 60 GACTGACTGACTGACTGACTGACTGACTGACTGACCCCTTGGTATGATAGGTTTTCCAAT 72.82 F 0.4
65 C 65 GACTGACTGACTGACTGACTGACTGACTGACTGACTGACTTGTTCTGTATTCCGCGTAGCCTGTT 74.74 F 0.4
30 H 30 GACTGCAAGTTGTCTTAGCACATCACCAAA 60.8 F 0.4
35 H 35 GACTGACTGACTGACTGCGCAAGTTACCTGGAAGC 66.3 R 0.4
40 H 40 GACTGACTGACTGACTGCGTATCCAGACAGCGATGTAACA 66.4 R 0.4
45 H 45 GACTGACTGACTGACTGACTGAATTGTTCCATCTTCTAGCATCTT 64.7 F 0.1
50 H 50 GACTGACTGACTGACTGACTGACTGACTCGAATTTTAGGTTCGTTGATTT 65.8 R 0.1
55 H 55 GACTGACTGACTGACTGACTGACTGACTGACTTTAGACTCGCCGTTAATTTCCAT 71.31 F 0,4
60 H 60 GACTGACTGACTGACTGACTGACTGACTGACTGACTGATTTGTCACTGGGAAGGAAATGT 72.82 R 0.2
  1. aThe letter of the primer name indicates the target is either the coat protein (C) or the helper-component protease (H) segment of the genome.
  2. bEach primer contains a segment that anneals to the template (underlined) and a GACT tail to adjust the length of the primer.
  3. cThe primer anneals to either the forward (F) or reverse (R) strand. nt, nucleotide; WSMV, Wheat streak mosaic virus.