Skip to main content

Table 1 Cytochrome b primers for PCR amplification of feather samples

From: Feather barbs as a good source of mtDNA for bird species identification in forensic wildlife investigations

Primera Sequences (5'→3') Amplicon
length, bp
Targeted taxa
EG-F10 CTAGGAATCTGCCTACTAACACAAA 297 Passeriformes
EG-R305 TCATGGGAGTACGTAGCCTACGA   
EG-F144 CGCCAATGGAGCATCCTTCTTC 219 Passeriformes
EG-R370 CAATGTAAGGGATGGCTGAGAATA   
GA-F407 GRGGRCAAATATCATTYTGAGG 220 Galliformes/
Anseriformes
GA-R627 GGRTTGTTTGAGCCYGATTCG   
GC-F108 CCTCCTCGGAATCTGCCTAAC 241 Glaucidium Sp.
GC-R349 CTGTGTTYCAGGTTTCTTTGTG   
AH-F122 GCCTAATGACACAAATCCTAACCG 200 Ardea Sp.
AH-R322 ACGAGCCGTAATAGAGTCCGC   
  1. aF and R in the primer name denote forward and reverse primers, respectively.