Skip to main content

Advertisement

Table 2 Single base extension (SBE) primer sequences and final concentrations used in the study, grouped by assay.

From: Development of a single base extension method to resolve Y chromosome haplogroups in sub-Saharan African populations

SNP   SBE primer (5' - 3') Size (mers) Concentration (μM) Assay
SRY10831 FW (C)3CTCTTGTATCTGACTTTTTCACACAGT 30 0.10 YSNP1
M168 FW (C)12TGGAGTATGTGTTGGAGGTGAGT 35 0.40  
M89 RV (GACT)2(C)10CAACTCAGGCAAAGTGAGAGAT 40 0.40  
M201 FW (GACT)2(C)9AGATCTAATAATCCAGTATCAACTGAGG 45 0.40  
M69 FW (GACT)4(C)11GGAGGCTGTTTACACTCCTGAAA 50 0.40  
M170 FW (GACT)4(C)9ACTATTTTATTTACTTAAAAATCATTGTTC 55 0.80  
M172 FW (GACT)7(C)12CCAAACCCATTTTGATGCTT 60 0.40  
M9 FW (GACT)8(C)11AAACGGCCTAAGATGGTTGAAT 65 0.40  
M207 FW (GACT)8(C)11GCAAATGTAAGTCAAGCAAGAAATTTA 70 0.80  
M198 FW (GACT)9(C)9TCAGTATACCAATTAATATTTTTGAAAGAG 75 0.80  
M343 FW (GACT)13(C)9AGAGTGCCCTCGTGTTCCA 80 0.40  
M91 FW CCTACATTGCTATTCTGTTTTTTTT 25 0.60 Hg-A
M31 RV (C)8CCACTGCTGTTCTGTCTACCA 29 0.60  
M14 RV (C)5CTTCATTAACTTTTTTAAACTGCTTATA 33 0.60  
M114 RV (C)15AGCTGTACAAGGCTCTTCAAAT 37 0.60  
P28 FW (C)14GGTTAAAAGAAAAAAGCTCTCAGATAG 41 0.40  
M28 RV (C)27TCGAGGTCCTCTGGCATC 45 0.50  
M51 RV (C)29CTCTGATCCCTGTTGGAAGC 49 0.50  
M13 FW (C)31GTAGGTTAAGGGCAAGACGGTTA 54 0.60  
M171 RV (C)32AGGTCTCTGACTGTTCAGTTTTATT 57 0.50  
M118 RV (C)35CAGCTGACACTTGTGTTTTCTTTATA 61 0.20  
M60 FW (C)3TTACATTTCAAAATGCATGACTTAAAG 30 0.40 Hg-B
M146 RV (C)11CTAAAACCCAGTGTTAATTACCCG 35 0.80  
M182 FW (C)13CTTAAAGCAGTGGTTAATGTAAACAAA 40 0.80  
M150 FW (C)22TGCCCACACACACAGATAGAAGT 45 0.80  
M152 FW (C)23GCTTTCTCCTGATAATGTTCTTCTTCT 50 0.80  
M108 RV (C)27CTTTTCTCTGACATTCAGGTATAGTTTC 55 0.30  
M43 FW (C)39CTCTTTCCATGGCCAACAAAC 60 0.40  
M112 FW (C)38AAAGAGGTGAGATAAAAACAAAGCAGT 65 0.40  
P6 FW (C)3TCAATAGAGGTTTCCACAGTTAAGTCT 30 0.10 Hg-B2b
M115 FW (C)3CAGAGTTTAAATTAGTATTTGATTTCACATTA 35 0.80  
M30 FW (C)14ATCATGTTTTAAGTCCTGACATCTGT 40 0.10  
P7 FW (C)21CCATCACCTGGGTAAAGTGAATTA 45 0.40  
P8 FW (C)27GCAGCTCACCTTTCATTTAGGTC 50 0.20  
M211 FW (C)30TAGGCAAAAGGATGTTAACAACAAG 55 0.80  
M40 RV (C)10TCTTCACCCTGTGATCCGCT 30 0.60 Hg-E
M33 FW CGATCTGTTCAGTTTATCTCATAAGTTACTAGTTA 35 0.30  
M44 RV (C)11AGGAAATCTCCTAACCTTCTAGTACACTG 40 0.40  
M75 FW (C)20AAAAGACAATTATCAAACCACATCC 45 0.10  
M41 FW (C)30TGGCCAACATGGTGAAACTG 50 0.50  
M85 RV (C)24GCTTGTGTTCTATTAAGTGTAGTTTTGTTAG 55 0.20  
P2 RV (GACT)8(C)8AGGTGCCCCTAGGAGGAGAA 60 0.40  
M2 RV (GACT)9(C)6CCCTTTATCCTCCACAGATCTCA 65 0.60  
M35 RV (GACT)10(C)9TTCGGAGTCTCTGCCTGTGTC 70 0.80  
M58 FW (C)5ATTTATTGTCTTCTGCAGAATTGGC 30 0.10 Hg-E1b1a
M116 FW (C)5GCTTTCTGAAAAAATAATTTCAAACTGATA 35 0.40  
M149 FW (C)9CTAACAAAACTACACTTAATAGAACACAAGC 40 0.10  
M154 RV (C)16GTGTTACATGGCCTATAATATTCAGTACA 45 0.40  
M155 RV (C)23AATTCAGAATATTTCATCTCTGGTCAC 50 0.40  
M10 FW (C)26AATTTTTTTGTTTATTCCCAATGATCTTA 55 0.50  
M191 FW (GACT)5(C)10ATTTACATTTTTTTCTTTACAACTTGACTA 60 0.40  
M78 FW AATTGATACACTTAACAAAGATACTTCTTTC 31 0.80 Hg-E1b1b1
M148 RV (C)7TTTCTAGGTAACGTATGTAGACATTTCTG 36 0.80  
M81 FW (C)15AGAGGTAAATTTTGTCCTTTTTTGAA 41 0.80  
M107 FW (C)18TAAGCCAACGTATTAACCTTCTAATTTC 46 0.20  
M165 RV (C)20AAATATTTCAGGTAAAACCACTCTATTAGTA 51 0.40  
M123 FW (C)27AAAGTCACAGTATCTGAACTAGCATATCA 56 0.80  
M34 FW (GACT)7(C)13GCCTGGCTTCCACCCAGGAG 61 0.20  
M136 RV (GACT)8(C)12GGTGAGCAGCATTGAGGAAGAC 66 0.10  
M281 RV (GACT)8(C)11AGGTTGCACAAACTCAGTATTATTAAAC 71 0.80  
  1. SNP, single nucleotide polymorphism; FW, forward orientation; RV, reverse orientation