Skip to main content

Advertisement

Table 1 Polymerase chain reaction (PCR) primer sequences, amplicon lengths and final PCR primer concentrations used in the study.

From: Development of a single base extension method to resolve Y chromosome haplogroups in sub-Saharan African populations

SNP Primer (5' - 3')   Fragment size (mers) Concentration (μM) Assay
  Forward Reverse    
M170 CTAGTATGCTTCACACAAATGCG GACCACACAAAAACAGGTCCTC 390 0.08 YSNP1
M207 AAGGGCAAGCAAAATAGCAATAC TGTTCGCTGCTACGAATCTTT 363 0.08  
M201 CATGGGTAATTCGGTTGTTACC CTAAACATCATGGTGTGACGAAC 331 0.08  
M168 GGTTTGAATGAGACTGGGTCA TGGTAATCTCATAGGTCTCTGACTG 295 0.08  
M343 AGGTAGGAGGATCCAAAGCTGA CACCTTTGTCCTCTTGCTCTTT 276 0.08  
M9 TGCAGCATATAAAACTTTCAGGAC TTCCTCATTTTTGAAGCTCGTG 241 0.08  
M69 TCAGCCATTTCACCAAAACTCT CTGAAGAAACAAACCTACCTGGAA 233 0.08  
M89 CCAAGCTGGTGAGTCTTATCCT GCAGAATAGCTGCTCAGGTACA 215 0.08  
M172 CAGAAGATGCCCCATTATATCCT ACTCCATGTTGGTTTGGAACAG 208 0.08  
M198 TAGGCACTTGGGAACTTACACTC TTCTTGTGATAGCATGCCGTTT 178 0.08  
SRY10831 CATCCAGTCCTTAGCAACCATT AATGACACAAGGCACCACATAG 163 0.08  
P28 TTTTGAGAGAAGACAAGGGGGATA TTGGAGGGACATTATTCTCCTGA 559 0.20 Hg-A
M13-M14* ATCACGCCCCTCTCATTGTC AGCTCTAGATAAAAGCACATTGACACC 457 0.08  
M91 GATCACAAAGACCTGGACAGATTACA AACGGAAATGCCAAGAATCGTA 429 0.05  
M31 GCTGAAACAATAGTTCTTCACAATGG CAGTCCTATGCATAATGCCGTGT 400 0.03  
M114 GCCTTGATTTTCTTCGTACTTCATAAG CCAGTTTCTCACTGAGTTCATTCCTT 370 0.06  
M28 GGGCTTCAGTTCTTGACGCTAC CCGTCTTAATTTTGCGGTATTCAA 329 0.04  
M51 AAACCACACCTGTCTTACCAGAGC CTGTTCCCCAGTTTTCAATCTCC 293 0.04  
M171 GGCTGTGTGGAGTATGTGTTGG CAAATATCCTGCCCCAGCTTAGT 217 0.04  
M118 TCCCTTGAAATTAAGGACAACAACT CATTCTTCTCAACCAGCTGACACT 167 0.06  
M43 GACTCCATAAGCAAAAGGTCATCAA AAAAGAAGTTGAGGACTGGAGCA 518 0.12 Hg-B
M112 GGCCATGCTAACAGAGATCTGAC CACAGTTCAATTCTTGTCTGTTGC 493 0.08  
M152 AAGCAAAAAGCTCCTTCTGAGGT CAGAAGGTGGATCAGGGTAGAAA 381 0.08  
M182 CATTTTTGTGTCAGGTATCCTTTGT CAAGACGGCGTATCAACTCAAG 368 0.12  
M108 GCTTTTCTAACACCACCCATGAC TATGTGATAGAGGTGGCTTTAAGTGG 342 0.08  
M150 CCAGGCTAGCAGTGGAGATGAA AGGGTGGACTGCTGACCTACTTT 312 0.08  
M146 TTACAGGTGGAATGGGGTGTTAC GAGAAGAACTGCCTTCCATGACATA 279 0.08  
M60 CCTGATGTGGACTCAACCTTGTA TGTTCATTATGGTTCAGGAGGAG 250 0.08  
M211 CACTGCACACACTACACTGACCAC ATGTTGATTGGGTAGAGCCCTTT 386 0.06 Hg-B2b
P6 TATTAGGGAAATCACTCAGGATGGT TCTACGAATGTTTAACCTCAGATACCG 343 0.12  
P8 AGTTGTTGGAAAGCCTCTGTTCA TGATACTAGACGTGGCATCTTGTCA 313 0.06  
M115 TGCCATGCTTGTTTCTTAATCCA AACTATGTTGCACATCAGCCTCA 270 0.12  
P7 GGCCAAAGCCTAGAATGAAATTG AAGTGCTTGTCCAAGGCAGTATAA 228 0.16  
M30 ACAAATCATGAGCTTACAGAACCTG GGCACAGCCAGATAACCCTACA 200 0.12  
M40-M41* TAGCTGGTATGACAGGGGATGAT GGGTAGGATAGGCTAGCTATTACGC 435 0.08 Hg-E
M2 GGAGAAGAACGGAAGGAGTTCTAA ACTTGCCAGAGACTTCCAGTTTG 372 0.12  
M85† GAACTGGCATCCAATACTAGCTGA TCACCTCTTTTGTATTGGCTTCTTC 350 0.08  
P2 TGGTCTGGTAACACCCATAAAGGT GCAGTTTTCTCAGATGCTTCTCCTA 335 0.08  
M35 GCCTAAAGAGCAGTCAGAGTAGAATG GAGAATGAATAGGCATGGGTTCA 303 0.08  
M75 GTCACATTCCACACATCAAGAAAACT GTGAATCTCTGCCCAGAAAAGAAAA 274 0.12  
M44 ATTGGATATGGAAGCCAGTCTCA ATGTGTTTGAGGACCACCCTAGA 250 0.12  
M33 GGCTTCTGTTCAATTTTCCTTTGAT TTATTTGTTGAAGCCCCCAAGAG 223 0.08  
M10 GTTCAAGACAATGAAGGGAGAGACT TGACATTGACCTGCAGCATAGG 520 0.08 Hg-E1b1ba
M191 GAGCAAGTACAGCGAGCAGTAAG GGTTTAACACAATGCAGGTCAATTC 480 0.08  
M154† CAATGGAGGCTATAGGTGATTGC CTGTTTGTTCATGGAGATGTCTGTA 461 0.08  
M149† GAACTGGCATCCAATACTAGCTGA TCACCTCTTTTGTATTGGCTTCTTC 350 0.06  
M116 TATGAAGTACGAAGAAAATCAAGGCTA TGGGTAGAAAAACTGCAAGTAGATGA 328 0.12  
M58-M155* TGGGCCTGACCTCTTAACTTGTA CATAATAAGCTAAGAAACATCCAGCCT 293 0.06  
M81† CAATGGAGGCTATAGGTGATTGC CTGTTTGTTCATGGAGATGTCTGTA 461 0.10 Hg-E1b1b1
M123-M281* CTAATTCATGCTCTCAGGGGAAA ATAACCTCTGGAAGTGTGTCTTTACCT 404 0.10  
M107 AATCCCACCTCACATACACATAAGC AGGGGTTGACAAGAAAAAGGAATA 386 0.06  
M148† GAACTGGCATCCAATACTAGCTGA TCACCTCTTTTGTATTGGCTTCTTC 350 0.08  
M78 ATGGCTGTATGGGTTTCTTTGACT CGGAATATGGACAGTCATCGTATT 330 0.08  
M165 CAAGTCAGCAAGGAGTAGGTGGA TTGCACTGACACAAGTTATCTCCCT 293 0.08  
M34 GATAACCTCATTGTGGAGAGCACTT ATGCTAAAGCAAGTAACCCTGTGG 254 0.10  
M136 ACCAACCGTATTACCTTCTCCTCA CATGAGTCCAAAGTATAGTGGGCTA 226 0.10  
  1. * Due to the close proximity of the single nucleotide polymorphisms (SNPs), a single amplicon was used.
  2. Again, a single amplicon was used for these SNPs, but in different assays.