Skip to main content

Table 3 Overview of PCR primer sets used in this study

From: Forensic identification of severely degraded Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) tissues

Primer name Sequence 5" to 3" Ta, °Ca Amplicon
size, bp
Short fragment COI primers   
OmyCOI032F ATAGTAGGCACCGCCCTGAGTCTAC 62.0 52
OmyCOI032R CCGGCTGGCTTAGTTCCGCC   
OmyCOI203F CTAATAATCGGAGCCCCTGATATG 62.0 73
OmyCOI203R AGGATGGAGGAAGGAGTCAGAAG   
OmyCOI340F CCCTCTAGCCGGCAACCTC 62.0 62
OmyCOI340R GAAGGGAGAAGATAGTTAAATCAACAGAG   
SsaCOI030F GAATAGTCGGCACCGCCCTAAGTCTCT 62.0 57
SsaCOI030R CGCCAGGCTGGCTGAGTTCTGCT   
SsaCOI208F AATCGGGGCCCCCGACATA 62.0 71
SsaCOI208R GAAAGGAGGGAGGGAGAAGTCAAAAA   
SsaCOI334F CTACCCCCCTCTAGCAGGTAATCTT 62.0 65
SsaCOI334R GGGAAAAAATAGTTAAGTCAACGGAA   
SsaCOI076F CCAGCCTGGCGCCCTTCTG 62.0 63
SsaCOI076R AAGGCATGGGCTGTAACAATTACGTT   
SsaCOI213F GGGCCCCCGACATAGCAT 62.0 65
SsaCOI213R AAAGGAGGGAGGAGAAGTCAAAAA   
SsaCOI401F CATTTGGCTGGTATTTCTTCAATTCTT 62.0 75
SsaCOI401R AGCTGGGGGTTTTATATTAATAATGGTT   
Barcoding COI primers b  
Fish1F TCAACCAACCACAAAGACATTGGCAC 55.0 704
Fish1R TAGACTTCTGGGTGGCCAAAGAATCA   
Microsatellite primers  
Omm1303F c GGAAGGAAAGGCACTT 55.0 285 to 375e
Omm1303R c TCTACACCAGGAGAGAGTAAT   
Sp2201F d TTAGATGGTGGGATACTGGGAGGC 55.0 250 to 350e
Sp2201R d CGGGAGCCCCATAACCCTACTAATAAC   
  1. aTa = the routine PCR annealing temperature used for each primer set;
  2. buniversal barcoding primers [37]; crainbow trout microsatellite [39]; dAtlantic salmon microsatellite [38]; emicrosatellite allele sizes were derived from farmed fish surveys.