Development of a single base extension method to resolve Y chromosome haplogroups in sub-Saharan African populations

  • Thijessen Naidoo1Email author,

    Affiliated with

    • Carina M Schlebusch1,

      Affiliated with

      • Heeran Makkan1,

        Affiliated with

        • Pareen Patel1,

          Affiliated with

          • Rajeshree Mahabeer1,

            Affiliated with

            • Johannes C Erasmus1 and

              Affiliated with

              • Himla Soodyall1

                Affiliated with

                Investigative Genetics20101:6

                DOI: 10.1186/2041-2223-1-6

                Received: 4 February 2010

                Accepted: 1 September 2010

                Published: 1 September 2010

                Abstract

                Background

                The ability of the Y chromosome to retain a record of its evolution has seen it become an essential tool of molecular anthropology. In the last few years, however, it has also found use in forensic genetics, providing information on the geographic origin of individuals. This has been aided by the development of efficient screening methods and an increased knowledge of geographic distribution. In this study, we describe the development of single base extension assays used to resolve 61 Y chromosome haplogroups, mainly within haplogroups A, B and E, found in Africa.

                Results

                Seven multiplex assays, which incorporated 60 Y chromosome markers, were developed. These resolved Y chromosomes to 61 terminal branches of the major African haplogroups A, B and E, while also including a few Eurasian haplogroups found occasionally in African males. Following its validation, the assays were used to screen 683 individuals from Southern Africa, including south eastern Bantu speakers (BAN), Khoe-San (KS) and South African Whites (SAW). Of the 61 haplogroups that the assays collectively resolved, 26 were found in the 683 samples. While haplogroup sharing was common between the BAN and KS, the frequencies of these haplogroups varied appreciably. Both groups showed low levels of assimilation of Eurasian haplogroups and only two individuals in the SAW clearly had Y chromosomes of African ancestry.

                Conclusions

                The use of these single base extension assays in screening increased haplogroup resolution and sampling throughput, while saving time and DNA. Their use, together with the screening of short tandem repeat markers would considerably improve resolution, thus refining the geographic ancestry of individuals.

                Background

                The Y chromosome has demonstrated its utility, for a number of years, in shedding light on human history and identifying population affinities. Given that human genome variation evolves over time due to several factors - among them mutation, genetic drift, migration and selection - the genome has retained some of the record of these historical and evolutionary events. This record is more easily read from the Y chromosome due to the lack of recombination along most of its length and a strict paternal mode of transmission. Consequently, the Y chromosome has become a marker of the male contribution to the shaping of human populations and their histories.

                A standard nomenclature established by the Y Chromosome Consortium [1] resolved the global pattern of Y chromosome variation into 18 major haplogroups that were classified using capital letters A through to R. This has recently been revised by Karafet et al.[2] to a Y chromosome haplogroup phylogeny that contains 311 branches delineated by approximately 600 markers (primarily bi-allelic) and includes an additional two haplogroups (S and T), increasing the major haplogroup number to 20. The frequency and distribution of these haplogroups shows good concordance with the geographic distribution of populations. This, together with high levels of population differentiation, [3] have added value to the Y chromosome as a tool for reconstructing the history and migrations of humans over time.

                While Y chromosome short tandem repeats (STRs) are now used routinely in forensic analysis [4], the use of bi-allelic markers - mainly single nucleotide polymorphisms (SNPs) - which designate Y chromosome haplogroups, is advancing steadily due to their ability to provide information on the geographic origin of individuals. Their use, however, is hindered by the paucity of simple screening methods and insufficient knowledge of their global distribution. However, this has improved in recent years [5]

                A number of assays for the rapid screening of Y chromosome haplogroups have been developed [69]. These were targeted primarily at resolving the major haplogroups found in European populations. While these studies have included in their assays a few SNPs to resolve the major Y chromosome haplogroups commonly found in sub-Saharan Africa, they do not contain the markers needed to resolve the majority of terminal branches of the Y chromosome phylogeny that exist among African populations.

                In the present study, we report on the development of single base extension (SBE) assays used to refine the resolution of Y chromosome haplogroups commonly found in Africa, having also incorporated a few SNPs to delineate the common non-African Y chromosomes following a hierarchical screening process. SBE, due to its convenience and relative affordability, is now used in many genetic and forensic applications. Following the validation of the assays, we applied these methods in order to resolve the Y chromosome haplogroups in 683 male subjects, primarily from southern Africa. Haplogroup frequencies for the populations analysed were then calculated.

                Results and discussion

                SNP selection and screening strategy

                Seven multiplex SBE assays, which incorporated 60 Y chromosome markers described in the YCC Phylogeny 2003 [10], were developed which resolved 61 Y chromosome haplogroups. The first multiplex, YSNP1, consisted of the markers SRY10831, M168, M89, M201, M69, M170, M172, M9, M207, M198 and M343 (Figure 1a). YSNP1 resolved Y chromosomes into either the African haplogroups (A, B or E) or Eurasian haplogroups found occasionally in African males [unpublished restriction fragment length polymorphism (RFLP) data]. Note: the marker, SRY10831, initially resolves haplogroup BR, while its reversion is used to define haplogroup R1a.
                http://static-content.springer.com/image/art%3A10.1186%2F2041-2223-1-6/MediaObjects/13323_2010_Article_6_Fig1_HTML.jpg
                Figure 1

                Electropherogram and phylogeny of (a) YSNP1, (b) Hg-A, (c) Hg-B, (d) Hg-B2b, (e) Hg-E, (f) Hg-E1b1a, and (g) Hg-E1b1b1. The markers shown in parentheses are there to indicate the hierarchical nature of the phylogenies, and are not a part of the panels they are shown with.

                Any sample found to harbour the ancestral state at all markers within YSNP1 was screened using the multiplex assay, Hg-A. This multiplex consisted of the markers, M91, M31, M14, M114, P28, M28, M51, M13, M171 and M118 (Figure 1b) and was used to resolve the sub-clades of haplogroup A. Samples found to be derived at SRY10831, but ancestral at all other markers within YSNP1, were screened using the multiplex assay, Hg-B. This multiplex consisted of M60, M146, M182, M150, M152, M108, M43 and M112 (Figure 1c) and resolved the sub-clades of haplogroup B. Those samples with the derived allele at M112 were screened further, using the multiplex assay, Hg-B2b, which contained the markers P6, M115, M30, P7, P8 and M211 (Figure 1d), providing resolution of haplogroup B2b samples to the terminal branches of the phylogeny. While M108 recurs in haplogroup B2b resolving haplogroup B2b3a, its presence in the Hg-B multiplex assay should be sufficient to resolve both its occurrences in haplogroup B, thus negating the need to include it in the Hg-B2b assay.

                Those samples found to be derived at SRY10831 and M168, while remaining ancestral at all other markers within YSNP1, could be assigned to haplogroups C, D or E. These samples were then screened using the Hg-E multiplex assay, which consisted of M40, M33, M44, M75, M41, M85, P2, M2 and M35 (Figure 1e). Samples found to be derived for M2 or M35 would fall into haplogroups E1b1a or E1b1b1, respectively. E1b1a Y chromosomes were further resolved using the assay, Hg-E1b1a; a multiplex comprised of the markers M58, M116, M149, M154, M155, M10 and M191 (Figure 1f). Those Y chromosomes assigned to haplogroup E1b1b1 were screened further using the multiplex assay, Hg-E1b1b1, which consisted of the markers M78, M148, M81, M107, M165, M123, M34, M136 and M281 (Figure 1g). When a sample was found to be ancestral for the M40 polymorphism, it was screened for the mutations that defined haplogroups C (M130) and D (M174) separately. This hierarchical screening approach facilitated the resolution of the relevant haplogroup in an individual after one, two, or at most, three reactions, depending on the haplogroup present.

                Polymerase chain reaction (PCR) optimization

                While PCR primer concentrations were initially 0.02 μM - 0.04 μM, these were increased or decreased incrementally in order to obtain a relatively equal amplification of amplicons in the multiplex PCR (see Table 1). The marker P28, in the Hg-A assay, initially experienced low amplification after multiplexing. This was rectified by increasing the final concentration of the P28 PCR primers to 0.2 μM, and decreasing the buffer concentration to 0.8×. The annealing temperature was also optimized in order to ensure maximum product yield and to minimize the formation of spurious products. A spurious amplification product was found to occur in the Hg-E1b1b1 assay which was eliminated by increasing the annealing temperature to 61°C.
                Table 1

                Polymerase chain reaction (PCR) primer sequences, amplicon lengths and final PCR primer concentrations used in the study.

                SNP

                Primer (5' - 3')

                 

                Fragment size (mers)

                Concentration (μM)

                Assay

                 

                Forward

                Reverse

                   

                M170

                CTAGTATGCTTCACACAAATGCG

                GACCACACAAAAACAGGTCCTC

                390

                0.08

                YSNP1

                M207

                AAGGGCAAGCAAAATAGCAATAC

                TGTTCGCTGCTACGAATCTTT

                363

                0.08

                 

                M201

                CATGGGTAATTCGGTTGTTACC

                CTAAACATCATGGTGTGACGAAC

                331

                0.08

                 

                M168

                GGTTTGAATGAGACTGGGTCA

                TGGTAATCTCATAGGTCTCTGACTG

                295

                0.08

                 

                M343

                AGGTAGGAGGATCCAAAGCTGA

                CACCTTTGTCCTCTTGCTCTTT

                276

                0.08

                 

                M9

                TGCAGCATATAAAACTTTCAGGAC

                TTCCTCATTTTTGAAGCTCGTG

                241

                0.08

                 

                M69

                TCAGCCATTTCACCAAAACTCT

                CTGAAGAAACAAACCTACCTGGAA

                233

                0.08

                 

                M89

                CCAAGCTGGTGAGTCTTATCCT

                GCAGAATAGCTGCTCAGGTACA

                215

                0.08

                 

                M172

                CAGAAGATGCCCCATTATATCCT

                ACTCCATGTTGGTTTGGAACAG

                208

                0.08

                 

                M198

                TAGGCACTTGGGAACTTACACTC

                TTCTTGTGATAGCATGCCGTTT

                178

                0.08

                 

                SRY10831

                CATCCAGTCCTTAGCAACCATT

                AATGACACAAGGCACCACATAG

                163

                0.08

                 

                P28

                TTTTGAGAGAAGACAAGGGGGATA

                TTGGAGGGACATTATTCTCCTGA

                559

                0.20

                Hg-A

                M13-M14*

                ATCACGCCCCTCTCATTGTC

                AGCTCTAGATAAAAGCACATTGACACC

                457

                0.08

                 

                M91

                GATCACAAAGACCTGGACAGATTACA

                AACGGAAATGCCAAGAATCGTA

                429

                0.05

                 

                M31

                GCTGAAACAATAGTTCTTCACAATGG

                CAGTCCTATGCATAATGCCGTGT

                400

                0.03

                 

                M114

                GCCTTGATTTTCTTCGTACTTCATAAG

                CCAGTTTCTCACTGAGTTCATTCCTT

                370

                0.06

                 

                M28

                GGGCTTCAGTTCTTGACGCTAC

                CCGTCTTAATTTTGCGGTATTCAA

                329

                0.04

                 

                M51

                AAACCACACCTGTCTTACCAGAGC

                CTGTTCCCCAGTTTTCAATCTCC

                293

                0.04

                 

                M171

                GGCTGTGTGGAGTATGTGTTGG

                CAAATATCCTGCCCCAGCTTAGT

                217

                0.04

                 

                M118

                TCCCTTGAAATTAAGGACAACAACT

                CATTCTTCTCAACCAGCTGACACT

                167

                0.06

                 

                M43

                GACTCCATAAGCAAAAGGTCATCAA

                AAAAGAAGTTGAGGACTGGAGCA

                518

                0.12

                Hg-B

                M112

                GGCCATGCTAACAGAGATCTGAC

                CACAGTTCAATTCTTGTCTGTTGC

                493

                0.08

                 

                M152

                AAGCAAAAAGCTCCTTCTGAGGT

                CAGAAGGTGGATCAGGGTAGAAA

                381

                0.08

                 

                M182

                CATTTTTGTGTCAGGTATCCTTTGT

                CAAGACGGCGTATCAACTCAAG

                368

                0.12

                 

                M108

                GCTTTTCTAACACCACCCATGAC

                TATGTGATAGAGGTGGCTTTAAGTGG

                342

                0.08

                 

                M150

                CCAGGCTAGCAGTGGAGATGAA

                AGGGTGGACTGCTGACCTACTTT

                312

                0.08

                 

                M146

                TTACAGGTGGAATGGGGTGTTAC

                GAGAAGAACTGCCTTCCATGACATA

                279

                0.08

                 

                M60

                CCTGATGTGGACTCAACCTTGTA

                TGTTCATTATGGTTCAGGAGGAG

                250

                0.08

                 

                M211

                CACTGCACACACTACACTGACCAC

                ATGTTGATTGGGTAGAGCCCTTT

                386

                0.06

                Hg-B2b

                P6

                TATTAGGGAAATCACTCAGGATGGT

                TCTACGAATGTTTAACCTCAGATACCG

                343

                0.12

                 

                P8

                AGTTGTTGGAAAGCCTCTGTTCA

                TGATACTAGACGTGGCATCTTGTCA

                313

                0.06

                 

                M115

                TGCCATGCTTGTTTCTTAATCCA

                AACTATGTTGCACATCAGCCTCA

                270

                0.12

                 

                P7

                GGCCAAAGCCTAGAATGAAATTG

                AAGTGCTTGTCCAAGGCAGTATAA

                228

                0.16

                 

                M30

                ACAAATCATGAGCTTACAGAACCTG

                GGCACAGCCAGATAACCCTACA

                200

                0.12

                 

                M40-M41*

                TAGCTGGTATGACAGGGGATGAT

                GGGTAGGATAGGCTAGCTATTACGC

                435

                0.08

                Hg-E

                M2

                GGAGAAGAACGGAAGGAGTTCTAA

                ACTTGCCAGAGACTTCCAGTTTG

                372

                0.12

                 

                M85†

                GAACTGGCATCCAATACTAGCTGA

                TCACCTCTTTTGTATTGGCTTCTTC

                350

                0.08

                 

                P2

                TGGTCTGGTAACACCCATAAAGGT

                GCAGTTTTCTCAGATGCTTCTCCTA

                335

                0.08

                 

                M35

                GCCTAAAGAGCAGTCAGAGTAGAATG

                GAGAATGAATAGGCATGGGTTCA

                303

                0.08

                 

                M75

                GTCACATTCCACACATCAAGAAAACT

                GTGAATCTCTGCCCAGAAAAGAAAA

                274

                0.12

                 

                M44

                ATTGGATATGGAAGCCAGTCTCA

                ATGTGTTTGAGGACCACCCTAGA

                250

                0.12

                 

                M33

                GGCTTCTGTTCAATTTTCCTTTGAT

                TTATTTGTTGAAGCCCCCAAGAG

                223

                0.08

                 

                M10

                GTTCAAGACAATGAAGGGAGAGACT

                TGACATTGACCTGCAGCATAGG

                520

                0.08

                Hg-E1b1ba

                M191

                GAGCAAGTACAGCGAGCAGTAAG

                GGTTTAACACAATGCAGGTCAATTC

                480

                0.08

                 

                M154†

                CAATGGAGGCTATAGGTGATTGC

                CTGTTTGTTCATGGAGATGTCTGTA

                461

                0.08

                 

                M149†

                GAACTGGCATCCAATACTAGCTGA

                TCACCTCTTTTGTATTGGCTTCTTC

                350

                0.06

                 

                M116

                TATGAAGTACGAAGAAAATCAAGGCTA

                TGGGTAGAAAAACTGCAAGTAGATGA

                328

                0.12

                 

                M58-M155*

                TGGGCCTGACCTCTTAACTTGTA

                CATAATAAGCTAAGAAACATCCAGCCT

                293

                0.06

                 

                M81†

                CAATGGAGGCTATAGGTGATTGC

                CTGTTTGTTCATGGAGATGTCTGTA

                461

                0.10

                Hg-E1b1b1

                M123-M281*

                CTAATTCATGCTCTCAGGGGAAA

                ATAACCTCTGGAAGTGTGTCTTTACCT

                404

                0.10

                 

                M107

                AATCCCACCTCACATACACATAAGC

                AGGGGTTGACAAGAAAAAGGAATA

                386

                0.06

                 

                M148†

                GAACTGGCATCCAATACTAGCTGA

                TCACCTCTTTTGTATTGGCTTCTTC

                350

                0.08

                 

                M78

                ATGGCTGTATGGGTTTCTTTGACT

                CGGAATATGGACAGTCATCGTATT

                330

                0.08

                 

                M165

                CAAGTCAGCAAGGAGTAGGTGGA

                TTGCACTGACACAAGTTATCTCCCT

                293

                0.08

                 

                M34

                GATAACCTCATTGTGGAGAGCACTT

                ATGCTAAAGCAAGTAACCCTGTGG

                254

                0.10

                 

                M136

                ACCAACCGTATTACCTTCTCCTCA

                CATGAGTCCAAAGTATAGTGGGCTA

                226

                0.10

                 

                * Due to the close proximity of the single nucleotide polymorphisms (SNPs), a single amplicon was used.

                Again, a single amplicon was used for these SNPs, but in different assays.

                SBE optimization

                The SBE primers designed for the seven SBE assays, ranging from 25 to 80 bases in length, were designed to differ by four to five bases within each assay (see Table 2). This was not always reflected in the electropherogram, with a lack of uniform separation in most of the assays. This resulted in a few extension products (for example, M85 and P2 in Hg-E, M168 and M89 in Hg-YSNP1) co-migrating (see Figure 1). Fortunately, this did not interfere with the interpretation of results. The estimated lengths of extension products in the electropherogram (based on mobility) differed from the designed lengths, on average by four bases. This difference was ascribed to the migration rate of the primer (which was influenced by its actual length), possible secondary structure [11], mobility of the dye attached [12] and the use of POP-7® polymer. This was especially apparent for the M91 primer, a 25-base primer which sized, on average, 11 bases larger. Despite these observations, profiles generated by all the assays were usually easily interpreted.
                Table 2

                Single base extension (SBE) primer sequences and final concentrations used in the study, grouped by assay.

                SNP

                 

                SBE primer (5' - 3')

                Size (mers)

                Concentration (μM)

                Assay

                SRY10831

                FW

                (C)3CTCTTGTATCTGACTTTTTCACACAGT

                30

                0.10

                YSNP1

                M168

                FW

                (C)12TGGAGTATGTGTTGGAGGTGAGT

                35

                0.40

                 

                M89

                RV

                (GACT)2(C)10CAACTCAGGCAAAGTGAGAGAT

                40

                0.40

                 

                M201

                FW

                (GACT)2(C)9AGATCTAATAATCCAGTATCAACTGAGG

                45

                0.40

                 

                M69

                FW

                (GACT)4(C)11GGAGGCTGTTTACACTCCTGAAA

                50

                0.40

                 

                M170

                FW

                (GACT)4(C)9ACTATTTTATTTACTTAAAAATCATTGTTC

                55

                0.80

                 

                M172

                FW

                (GACT)7(C)12CCAAACCCATTTTGATGCTT

                60

                0.40

                 

                M9

                FW

                (GACT)8(C)11AAACGGCCTAAGATGGTTGAAT

                65

                0.40

                 

                M207

                FW

                (GACT)8(C)11GCAAATGTAAGTCAAGCAAGAAATTTA

                70

                0.80

                 

                M198

                FW

                (GACT)9(C)9TCAGTATACCAATTAATATTTTTGAAAGAG

                75

                0.80

                 

                M343

                FW

                (GACT)13(C)9AGAGTGCCCTCGTGTTCCA

                80

                0.40

                 

                M91

                FW

                CCTACATTGCTATTCTGTTTTTTTT

                25

                0.60

                Hg-A

                M31

                RV

                (C)8CCACTGCTGTTCTGTCTACCA

                29

                0.60

                 

                M14

                RV

                (C)5CTTCATTAACTTTTTTAAACTGCTTATA

                33

                0.60

                 

                M114

                RV

                (C)15AGCTGTACAAGGCTCTTCAAAT

                37

                0.60

                 

                P28

                FW

                (C)14GGTTAAAAGAAAAAAGCTCTCAGATAG

                41

                0.40

                 

                M28

                RV

                (C)27TCGAGGTCCTCTGGCATC

                45

                0.50

                 

                M51

                RV

                (C)29CTCTGATCCCTGTTGGAAGC

                49

                0.50

                 

                M13

                FW

                (C)31GTAGGTTAAGGGCAAGACGGTTA

                54

                0.60

                 

                M171

                RV

                (C)32AGGTCTCTGACTGTTCAGTTTTATT

                57

                0.50

                 

                M118

                RV

                (C)35CAGCTGACACTTGTGTTTTCTTTATA

                61

                0.20

                 

                M60

                FW

                (C)3TTACATTTCAAAATGCATGACTTAAAG

                30

                0.40

                Hg-B

                M146

                RV

                (C)11CTAAAACCCAGTGTTAATTACCCG

                35

                0.80

                 

                M182

                FW

                (C)13CTTAAAGCAGTGGTTAATGTAAACAAA

                40

                0.80

                 

                M150

                FW

                (C)22TGCCCACACACACAGATAGAAGT

                45

                0.80

                 

                M152

                FW

                (C)23GCTTTCTCCTGATAATGTTCTTCTTCT

                50

                0.80

                 

                M108

                RV

                (C)27CTTTTCTCTGACATTCAGGTATAGTTTC

                55

                0.30

                 

                M43

                FW

                (C)39CTCTTTCCATGGCCAACAAAC

                60

                0.40

                 

                M112

                FW

                (C)38AAAGAGGTGAGATAAAAACAAAGCAGT

                65

                0.40

                 

                P6

                FW

                (C)3TCAATAGAGGTTTCCACAGTTAAGTCT

                30

                0.10

                Hg-B2b

                M115

                FW

                (C)3CAGAGTTTAAATTAGTATTTGATTTCACATTA

                35

                0.80

                 

                M30

                FW

                (C)14ATCATGTTTTAAGTCCTGACATCTGT

                40

                0.10

                 

                P7

                FW

                (C)21CCATCACCTGGGTAAAGTGAATTA

                45

                0.40

                 

                P8

                FW

                (C)27GCAGCTCACCTTTCATTTAGGTC

                50

                0.20

                 

                M211

                FW

                (C)30TAGGCAAAAGGATGTTAACAACAAG

                55

                0.80

                 

                M40

                RV

                (C)10TCTTCACCCTGTGATCCGCT

                30

                0.60

                Hg-E

                M33

                FW

                CGATCTGTTCAGTTTATCTCATAAGTTACTAGTTA

                35

                0.30

                 

                M44

                RV

                (C)11AGGAAATCTCCTAACCTTCTAGTACACTG

                40

                0.40

                 

                M75

                FW

                (C)20AAAAGACAATTATCAAACCACATCC

                45

                0.10

                 

                M41

                FW

                (C)30TGGCCAACATGGTGAAACTG

                50

                0.50

                 

                M85

                RV

                (C)24GCTTGTGTTCTATTAAGTGTAGTTTTGTTAG

                55

                0.20

                 

                P2

                RV

                (GACT)8(C)8AGGTGCCCCTAGGAGGAGAA

                60

                0.40

                 

                M2

                RV

                (GACT)9(C)6CCCTTTATCCTCCACAGATCTCA

                65

                0.60

                 

                M35

                RV

                (GACT)10(C)9TTCGGAGTCTCTGCCTGTGTC

                70

                0.80

                 

                M58

                FW

                (C)5ATTTATTGTCTTCTGCAGAATTGGC

                30

                0.10

                Hg-E1b1a

                M116

                FW

                (C)5GCTTTCTGAAAAAATAATTTCAAACTGATA

                35

                0.40

                 

                M149

                FW

                (C)9CTAACAAAACTACACTTAATAGAACACAAGC

                40

                0.10

                 

                M154

                RV

                (C)16GTGTTACATGGCCTATAATATTCAGTACA

                45

                0.40

                 

                M155

                RV

                (C)23AATTCAGAATATTTCATCTCTGGTCAC

                50

                0.40

                 

                M10

                FW

                (C)26AATTTTTTTGTTTATTCCCAATGATCTTA

                55

                0.50

                 

                M191

                FW

                (GACT)5(C)10ATTTACATTTTTTTCTTTACAACTTGACTA

                60

                0.40

                 

                M78

                FW

                AATTGATACACTTAACAAAGATACTTCTTTC

                31

                0.80

                Hg-E1b1b1

                M148

                RV

                (C)7TTTCTAGGTAACGTATGTAGACATTTCTG

                36

                0.80

                 

                M81

                FW

                (C)15AGAGGTAAATTTTGTCCTTTTTTGAA

                41

                0.80

                 

                M107

                FW

                (C)18TAAGCCAACGTATTAACCTTCTAATTTC

                46

                0.20

                 

                M165

                RV

                (C)20AAATATTTCAGGTAAAACCACTCTATTAGTA

                51

                0.40

                 

                M123

                FW

                (C)27AAAGTCACAGTATCTGAACTAGCATATCA

                56

                0.80

                 

                M34

                FW

                (GACT)7(C)13GCCTGGCTTCCACCCAGGAG

                61

                0.20

                 

                M136

                RV

                (GACT)8(C)12GGTGAGCAGCATTGAGGAAGAC

                66

                0.10

                 

                M281

                RV

                (GACT)8(C)11AGGTTGCACAAACTCAGTATTATTAAAC

                71

                0.80

                 

                SNP, single nucleotide polymorphism; FW, forward orientation; RV, reverse orientation

                While the generation of aspecific peaks did occur occasionally, this was usually due to insufficient purification of the PCR products resulting in the incorporation of the PCR primers or deoxyribonucleotide triphosphates (dNTPs) into the SBE reaction. The presence of one permanent aspecific peak did occur, however, in the Hg-B2b assay (a red peak between the P8 and M211 peaks). This peak seemed to be linked to the P7 primer, perhaps due to a problem during its synthesis, and was usually more visible when overall peak height was decreased.

                In order to intensify peak heights, the number of cycles in the SBE reaction program was increased from 25 to 35. While overall peak height improved, variability of peak heights within some assays was unavoidable, despite the adjustment of relative SBE primer concentrations. This was possibly influenced by the efficiency of interaction between SBE primers and template sequences.

                Validation of SBE assays

                The seven SBE assays were validated using samples whose haplogroup status was previously determined. A total of 683 samples were then screened. Additionally, sequencing was performed to confirm the presence of alleles for 15 mutations not screened for before the use of these SBE assays. These included M14, M114, M152, P6, P7, P8, M33, M44, M85, M58, M154, M34, M201, M198 and M343.

                The marker M91, in the Hg-A assay, is a homopolymer length variant associated with a single base deletion in a poly-T tract [13]. While the use of SBE in the screening of homopolymer variants is not common, the detection of the M91 mutation using the SBE method was successful. This was reaffirmed phylogenetically [14, 15] by the presence of this mutation exclusively in samples belonging to subclades of haplogroup A.

                The validation process resulted in the redesign of just two SBE primers, P28 and M35. The initial P28 SBE primer did not pick up the mutation, probably due to non-specific primer binding, while the initial M35 primer resulted in an extremely low peak height when the mutation was present. This was possibly due to the preferential amplification of the ancestral allele, or a lower efficiency of binding by the original SBE primer.

                Finally, in haplogroups B2b4* and B2b4b, P7 showed the presence of two different extension products, displaying both the ancestral and derived states, simultaneously. This also occurred in haplogroup B2b4a, with P8, additionally, exhibiting the same property. The presence of both states was confirmed when sequencing was performed. Thus, it is likely that all samples in haplogroups B2b4*, B2b4a and B2b4b will display two peaks at the relevant markers. This was, probably, a consequence of these markers being located within paralogous sequence variants [16]. It should be noted that such mutations are more susceptible to back-mutation through gene conversion, as it was with P25 [17]. For this reason, more stable markers that resolve these subclades of B2b4 would be preferable.

                Haplogroup assignment using SBE assays

                The sample of 683 males screened using the seven SBE assays was assigned to 26 of the 61 haplogroups that the assays collectively resolved (see Table 3 and Figure 2). The subclades of haplogroup A were found most commonly in the KS, at a frequency of 44.3%. Haplogroup A3b1 was the commonest (28.4%) and was also found to be present in the BAN at low levels (5.0%). The haplogroups A2*, A2a and A2b were found to be unique to the KS at frequencies of 2.7%, 4.4% and 8.7%, respectively. Haplogroup B was present at moderate frequencies in both the KS and the BAN. Its subclades, however, displayed differing distributions, with haplogroup B2a1a occurring at a substantially higher frequency in the BAN (16.0%) than in the KS (0.5%). The situation was reversed with regard to haplogroup B2b, with its subclades together constituting 10.9% of KS individuals, as compared to 0.3% in the BAN. Haplogroup E was the most common haplogroup in the BAN group (78.1%), with its subclades E1b1a* and E1b1a7 occurring at frequencies of 34.1% and 25.9%, respectively. While both these haplogroups occurred in the KS at 13.1% and 7.7%, respectively, the most frequent E subclade amongst the KS was E1b1b1* (15.8%). Haplogroups E2* and E2b1 were found at much higher frequencies (10.2% versus 1.6%) in the BAN compared with the KS. The haplogroups shared between the BAN and KS, described above, showed extremely significant differences in frequency between the two groups (Fisher's exact test: P < 0.0001; for haplogroup E2: P = 0.0001). Both the KS and the BAN showed low levels (3.3% and 0.6%, respectively) of assimilation of the Eurasian Y chromosome haplogroups I, K* (x R), R1a1, and R1b.
                Table 3

                Y chromosome haplogroup frequencies in south eastern Bantu speakers, Khoe-San, and South African Whites.

                Marker

                Haplogroup

                South eastern Bantu-speakers

                (%)

                Khoe-San

                (%)

                South African Whites

                (%)

                M14

                A2* (x A2a, A2b)

                  

                5

                2.7

                  

                M114

                A2a

                  

                8

                4.4

                  

                P28

                A2b

                  

                16

                8.7

                  

                M51

                A3b1

                17

                5.0

                52

                28.4

                  

                M152

                B2a1a

                55

                16.0

                1

                0.5

                  

                M112

                B2b* (x B2b1, B2b2, B2b3, B2b4)

                1

                0.3

                2

                1.1

                  

                P6

                B2b1

                  

                13

                7.1

                  

                P8

                B2b4a

                  

                5

                2.7

                  

                M40

                E* (x E1a, E1b1, E2)

                1

                0.3

                    

                M44

                E1a1

                    

                1

                0.6

                M2

                E1b1a* (x E1b1a1, E1b1a2, E1b1a3, E1b1a4, E1b1a5, E1b1a6, E1b1a7)

                117

                34.1

                24

                13.1

                1

                0.6

                M58

                E1b1a1

                11

                3.2

                2

                1.1

                  

                M154

                E1b1a4

                10

                2.9

                2

                1.1

                  

                M191

                E1b1a7

                89

                25.9

                14

                7.7

                  

                M35

                E1b1b1* (x E1b1b1a, E1b1b1b, E1b1b1c, E1b1b1d)

                5

                1.5

                29

                15.8

                2

                1.3

                M78

                E1b1b1a

                    

                12

                7.6

                M34

                E1b1b1c1* (x E1b1b1c1a)

                  

                1

                0.5

                1

                0.6

                M75

                E2* (x E2a, E2b1)

                4

                1.2

                1

                0.5

                  

                M85

                E2b1

                31

                9.0

                2

                1.1

                  

                M89

                F* (x G, H, I, J2, K)†

                    

                4

                2.5

                M201

                G

                    

                9

                5.7

                M170

                I

                  

                1

                0.5

                28

                17.8

                M172

                J2

                    

                6

                3.8

                M9

                K* (x R)†

                2

                0.6

                  

                2

                1.3

                M198

                R1a1

                  

                2

                1.1

                10

                6.4

                M343

                R1b

                  

                3

                1.6

                81

                51.6

                 

                TOTAL

                343

                 

                183

                 

                157

                 

                Included in the frequencies of haplogroups F* and K* are those lineages not included in the SBE assays, but typed using PCR or RFLP assays, namely P12F2 and M70.

                http://static-content.springer.com/image/art%3A10.1186%2F2041-2223-1-6/MediaObjects/13323_2010_Article_6_Fig2_HTML.jpg
                Figure 2

                Clustered column graphs of haplogroup frequencies in south eastern Bantu-speakers (BAN), Khoe-San (KS) and South African Whites (SAW).

                Y chromosomes in the SAW sample were resolved into macro-haplogroup F (89.2%) of which haplogroup R (58.0%) and haplogroup I (17.8%) together accounted for 75.8%. Haplogroup E comprised the rest of the SAW at 10.8%, with its subclade E1b1b1a found at a frequency of 7.6%. These low to moderate levels of E1b1b1 illustrate the spread of the haplogroup and its subclades into southern Europe and the Middle East, where they are often found. Only two SAW samples, however, clearly belonged to African haplogroups (E1a1 and E1b1a*).

                The haplogroup distributions and their relative frequencies in the BAN and the KS were consistent with previous studies which included these populations [1820], while those of the SAW were found to correlate strongly with the Western European populations from which the majority are derived [21].

                Conclusions

                Seven SBE assays containing 60 SNP markers were designed, which allowed for the rapid assignment of samples to Y chromosome haplogroups, more especially those belonging to the major African haplogroups A, B and E. The assays were designed based on markers found in the YCC phylogeny 2003 [10]. Since then many more markers have been discovered that have further resolved the phylogeny [2]. If needed, these new markers could be incorporated into the current SBE assays, thereby increasing resolution. The use of the current SBE assays in screening Y chromosomes, however, has still resulted in increased haplogroup resolution and sample throughput, and at the same time was quicker and made use of less DNA.

                Based on the abovementioned haplogroup frequencies, the KS and the BAN populations are discernable from each other with the KS exhibiting significantly higher frequencies of haplogroups A2, A3b1, B2b and E1b1b1. However, the BAN are identifiable by the strong presence of haplogroups B1a1a, E1b1a and E2. The SAW were appreciably different from both the KS and BAN. There were, however, considerable levels of admixture between the populations (especially the KS and BAN) due to their history of interaction. Consequently, while the elucidation of Y chromosome haplogroups is useful in African populations for both anthropological and forensic purposes, their use together with Y chromosome STR screening would considerably improve resolution and thus refine an individual's geographic ancestry.

                Methods

                DNA samples

                DNA samples from 683 individuals with diverse ethnic backgrounds were analysed in the present study. All DNA samples were collected with the subjects' informed consent, and this research was approved by the Human Research Ethics Committee (Medical) at the University of the Witwatersrand, Johannesburg (Protocol No. M050906). The sample included 383 south eastern Bantu speakers (BAN), 183 Khoe-San (KS) and 157 South African Whites (SAW).

                DNA extraction

                DNA from EDTA-blood was extracted using the salting-out method described by Miller et al.[22] and the Gentra Puregene Buccal Cell Kit (Qiagen, Germany) was used to extract DNA from buccal swabs according to the manufacturer's instructions. DNA was quantified using the NanoDrop ND-1000 Spectrophotometer (LabVIEW®, Coleman Technologies Inc, FL, USA) and diluted to 10 ng/μL using double distilled water.

                Primer design

                The sequences of the regions encompassing the polymorphisms were taken from GenBank. The PCR and SBE primers were designed using Primer3 software [23], before aligning them to human genomic sequences using the National Center for Biotechnology Information basic local alignment search tool (BLAST) in order to confirm template specificity. The screening software, AutoDimer [24] was used to check for primer-dimer and hairpin loop formation. High-performance liquid chromatography-purified primers were purchased via Roche from Metabion (Martinsried, Germany), diluted to 100 μM and frozen.

                PCR primer lengths ranged from 20 to 27 mers and GC percentage varied between 30% and 60%. Amplicons were designed to differ slightly in size in order to distinguish them following agarose gel electrophoresis to check the success of the PCR. In total, 53 pairs of PCR primers were designed encompassing all 60 SNPs (see Table 1). Fewer pairs of primers were needed, as some SNPs were co-amplified on the same amplicons (M13 and M14; M40 and M41; M58 and M155; M123 and M281; M81 and M154; M85, M148 and M149).

                Poly-C or Poly-GACT tails of differing lengths were added to the 5' end of most SBE primers (Table 2), so as to differentiate between them during capillary electrophoresis. SBE primer lengths ranged from 25 to 80 mers, and differed in size from each other by 4-5 mers.

                Multiplex PCRs

                Primer design was verified by performing simplex PCR, using a GeneAmp PCR system 9700 (Applied Biosystems, CA, USA), for each of the primer pairs. Thereafter, the multiplex PCRs were optimized to work with DNA at a concentration of 10 ng/μl (see Table 4), and were catalysed using FastStart Taq DNA Polymerase (Roche, Basel, Switzerland). Relative primer concentrations were adjusted in order to obtain balanced amplification of amplicons within each multiplex. The thermal cycler programmes were as follows: one cycle at 95°C for 6 min, 35 cycles at 95°C for 30 s, 54°C (for YSNP1), 55°C (for Hg-A, Hg-B, Hg-B2b, Hg-E and Hg-E1b1a) or 61°C (for Hg-E1b1b1) for 30 s, extending at 72°C for 30 s and a final extension of 72°C for 10 min. Following the optimization procedures, all multiplex PCRs produced the required amplification products at adequate yields. This was confirmed by running 5 μL of multiplex PCR product on a 2% Metaphore® agarose gel (Cambrex, NJ, USA).
                Table 4

                Polymerase chain reaction (PCR) reagent mixtures for multiplex single base extension assays.

                PCR reagent

                YSNP1

                Hg-A

                Hg-B

                Hg-B2b

                 

                Concentration

                Concentration

                Concentration

                Concentration

                DNA

                10 ng/μL

                10 ng/μL

                10 ng/μL

                10 ng/μL

                Buffer (10×)

                0.8×

                MgCl2 (25 mM)

                2 mM

                4 mM

                3 mM

                3 mM

                dNTPs 2.5 mM)

                300 μM

                200 μM

                200 μM

                200 μM

                Forward primer (10 μM)

                See Table 1

                See Table 1

                See Table 1

                See Table 1

                Reverse primer (10 μM)

                See Table 1

                See Table 1

                See Table 1

                See Table 1

                FastStart Taq (5 U/μL)

                1 U

                1 U

                1 U

                1 U

                ddH2O

                Made up to 25 μL

                Made up to 25 μL

                Made up to 25 μL

                Made up to 25 μL

                 

                Hg-E

                Hg-E1b1a

                Hg-E1b1b1

                 

                PCR reagent

                Concentration

                Concentration

                Concentration

                 

                DNA

                10 ng/μL

                10 ng/μL

                10 ng/μL

                 

                Buffer (10×)

                1.25×

                1.25×

                1.25×

                 

                MgCl2 (25 mM

                3 mM

                3 mM

                3 mM

                 

                dNTPs (2.5 mM)

                200 μM

                200 μM

                200 μM

                 

                Forward primer (10 μM)

                See Table 1

                See Table 1

                See Table 1

                 

                Reverse primer (10 μM)

                See Table 1

                See Table 1

                See Table 1

                 

                FastStart Taq (5 U/μL)

                1 U

                1 U

                1 U

                 

                ddH2O

                Made up to 25 μL

                Made up to 25 μL

                Made up to 25 μL

                 

                dNTP, deoxyribonucleotide triphosphate; ddH20, double distilled water

                Multiplex SBE

                Excess PCR primers and dNTPs were eliminated from the PCR product mixture, following amplification, using an enzymatic purification method. One unit of Exonuclease I (Exo I) and 0.5 units of Shrimp Alkaline Phosphatase (SAP) were added to 5 μL of amplification product and the resultant mixture incubated for 1 h at 37°C, followed by 15 min at 75°C.

                The multiplex SBE reactions were performed in a final volume of 5 μL, comprised of 1.5 μL purified amplification product, 1.5 μL of double distilled water, 1 μL of SNaPshot Multiplex Ready Reaction Mix (Applied Biosystems) and 1 μL of SBE primer mix, specific to the assay being conducted (see Table 2 for final primer concentrations). The thermal cycler programme was as follows: 96°C for 10 s, 50°C for 5 s and 60°C for 30 s for 35 cycles.

                Following the SBE reaction, excess dideoxyribonucleotide triphosphates (ddNTPs) were removed through the addition of 0.5 U of SAP to the 5 μL SBE product. The mixture was incubated for 1 h at 37°C, followed by 15 min at 75°C.

                Capillary electrophoresis

                Following post-extension treatment, 2 μL of SBE product was mixed with 0.5 μL of the internal size standard, GS120LIZ (Applied Biosystems) and 7.5 μL Hi-Di formamide (Applied Biosystems). This was then run on a 3130xl Genetic Analyzer (Applied Biosystems). The SNaPshot protocol was originally optimized for use with POP-4 polymer; modifications recommended by Applied Biosystems were incorporated for use of the POP-7 polymer (Applied Biosystems Manual P/N: 4367258). The resultant electropherograms (Figure 1) were analysed using GeneMapperID v3.2 software (Applied Biosystems).

                Assay validations

                Some of the markers used in the SBE assays were validated using a set of control samples, previously screened using RFLP assays. Those markers for which samples of known haplogroup were unavailable were sequenced in order to confirm the presence of the polymorphism. After the screening of the 683 samples, Fisher's exact tests were performed using GraphPad InStat version 3.10 32 bit for Windows (GraphPad Software, CA, USA, http://​www.​graphpad.​com), in order to test significance of differences in haplogroup frequency between the BAN and KS.

                Abbreviations

                BAN: 

                Bantu speaker

                dNTP: 

                deoxyribonucleotide triphosphate

                ddNTP: 

                dideoxyribonucleotide triphosphate

                ddH20: 

                double distilled water

                KS: 

                Khoe-San

                PCR: 

                polymerase chain reaction

                RFLP: 

                restriction fragment length polymorphism

                SAP: 

                shrimp alkaline phosphatase

                SAW: 

                South African White

                SBE: 

                single base extension

                SNP: 

                single nucleotide polymorphism

                STR: 

                short tandem repeat.

                Declarations

                Acknowledgements

                We are grateful to all subjects who participated in our research. This study was supported by grants awarded to: HS from the South African Medical Research Council, the Palaeontological Scientific Trust, the National Research Foundation and the University of the Witwatersrand; HS and TN from the National Health Laboratory Service Research Trust; and TN was supported by the National Research Foundation, the German Academic Exchange Service and the University of the Witwatersrand. We are also grateful to Professor Trefor Jenkins and colleagues in the Division of Human Genetics for assistance with fieldwork and processing of samples.

                Authors’ Affiliations

                (1)
                Human Genomic Diversity and Disease Research Unit, Division of Human Genetics, School of Pathology, University of the Witwatersrand and the National Health Laboratory Services

                References

                1. Y Chromosome Consortium: A nomenclature system for the tree of human Y-chromosomal binary haplogroups. Genome Res. 2002, 12: 339-348. 10.1101/gr.217602.View Article
                2. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF: New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Res. 2008, 18: 830-838. 10.1101/gr.7172008.PubMed CentralView ArticlePubMed
                3. Seielstad MT, Minch E, Cavalli-Sforza LL: Genetic evidence for a higher female migration rate in humans. Nat Genet. 1998, 20: 278-280. 10.1038/3088.View ArticlePubMed
                4. Daniels DL, Hall AM, Ballantyne J: SWGDAM developmental validation of a 19-locus Y-STR system for forensic casework. J Forensic Sci. 2004, 49: 668-683. 10.1520/JFS2003134.View ArticlePubMed
                5. Hammer MF, Behar DM, Karafet TM, Mendez FL, Hallmark B, Erez T, Zhivotovsky LA, Rosset S, Skorecki K: Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Hum Genet. 2009, 126 (5): 707-717. 10.1007/s00439-009-0727-5.PubMed CentralView ArticlePubMed
                6. Brion M, Sobrino B, Blanco-Verea A, Lareu MV, Carracedo A: Hierarchical analysis of 30 Y-chromosome SNPs in European populations. Int J Legal Med. 2005, 119: 10-15. 10.1007/s00414-004-0439-2.View ArticlePubMed
                7. Lessig R, Zoledziewska M, Fahr K, Edelmann J, Kostrzewa M, Dobosz T, Kleemann WJ: Y-SNP-genotyping - a new approach in forensic analysis. Forensic Sci Int. 2005, 154: 128-136. 10.1016/j.forsciint.2004.09.129.View ArticlePubMed
                8. Onofri V, Alessandrini F, Turchi C, Pesaresi M, Buscemi L, Tagliabracci A: Development of multiplex PCRs for evolutionary and forensic applications of 37 human Y chromosome SNPs. Forensic Sci Int. 2006, 157: 23-35. 10.1016/j.forsciint.2005.03.014.View ArticlePubMed
                9. Sanchez JJ, Børsting C, Hallenberg C, Buchard A, Hernandez A, Morling N: Multiplex PCR and minisequencing of SNPs--a model with 35 Y chromosome SNPs. Forensic Sci Int. 2003, 137: 74-84. 10.1016/S0379-0738(03)00299-8.View ArticlePubMed
                10. Jobling MA, Tyler-Smith C: The human Y chromosome: an evolutionary marker comes of age. Nat Rev Genet. 2003, 4: 598-612. 10.1038/nrg1124.View ArticlePubMed
                11. Konrad KD, Pentoney SL: Contribution of secondary structure to DNA mobility in capillary gels. Electrophoresis. 1993, 14: 502-508. 10.1002/elps.1150140177.View ArticlePubMed
                12. Tu O, Knott T, Marsh M, Bechtol K, Harris D, Barker D, Bashkin J: The influence of fluorescent dye structure on the electrophoretic mobility of end-labeled DNA. Nucleic Acids Res. 1998, 26: 2797-2802. 10.1093/nar/26.11.2797.PubMed CentralView ArticlePubMed
                13. Underhill PA, Passarino G, Lin AA, Shen P, Mirazón Lahr M, Foley RA, Oefner PJ, Cavalli-Sforza LL: The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann Hum Genet. 2001, 65: 43-62. 10.1046/j.1469-1809.2001.6510043.x.View ArticlePubMed
                14. Capelli C, Tschentscher F, Pascali VL: 'Ancient' protocols for the crime scene? Similarities and differences between forensic genetics and ancient DNA analysis. Forensic Sci Int. 2003, 131: 59-64. 10.1016/S0379-0738(02)00396-1.View ArticlePubMed
                15. Salas A, Bandelt H-J, Macaulay V, Richards MB: Phylogeographic investigations: the role of trees in forensic genetics. Forensic Sci Int. 2007, 168: 1-13. 10.1016/j.forsciint.2006.05.037.View ArticlePubMed
                16. Hammer MF, Blackmer F, Garrigan D, Nachman MW, Wilder JA: Human population structure and its effects on sampling Y chromosome sequence variation. Genetics. 2003, 164: 1495-1509.PubMed CentralPubMed
                17. Adams SM, King TE, Bosch E, Jobling MA: The case of the unreliable SNP: recurrent back-mutation of Y-chromosomal marker P25 through gene conversion. Forensic Sci Int. 2006, 159: 14-20. 10.1016/j.forsciint.2005.06.003.View ArticlePubMed
                18. Cruciani F, Santolamazza P, Shen P, Macaulay V, Moral P, Olckers A, Modiano D, Holmes S, Destro-Bisol G, Coia V: A back migration from Asia to sub-Saharan Africa is supported by high-resolution analysis of human Y-chromosome haplotypes. Am J Hum Genet. 2002, 70: 1197-1214. 10.1086/340257.PubMed CentralView ArticlePubMed
                19. Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonné-Tamir B, Bertranpetit J, Francalacci P: Y chromosome sequence variation and the history of human populations. Nat Genet. 2000, 26: 358-361. 10.1038/81685.View ArticlePubMed
                20. Wood ET, Stover DA, Ehret C, Destro-Bisol G, Spedini G, McLeod H, Louie L, Bamshad M, Strassmann BI, Soodyall H, Hammer MF: Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes. Eur J Hum Genet. 2005, 13: 867-876. 10.1038/sj.ejhg.5201408.View ArticlePubMed
                21. Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, Amorim A, Amos W, Armenteros M, Arroyo E, Barbujani G: Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Am J Hum Genet. 2000, 67: 1526-1543. 10.1086/316890.PubMed CentralView ArticlePubMed
                22. Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1998, 16: 1215-10.1093/nar/16.3.1215.View Article
                23. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000, 132: 365-386.PubMed
                24. Vallone PM, Butler JM: AutoDimer: a screening tool for primer-dimer and hairpin structures. Biotechniques. 2004, 37: 226-231.PubMed

                Copyright

                © Naidoo et al; licensee BioMed Central Ltd. 2010

                This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                Advertisement